ipyrad command line tutorial - Part II
This is the second part of the full tutorial for the command line interface for ipyrad. In the previous section we imported our data, did some QC, and created clusters of similar reads within each sample. In this section, we now continue with the assembly, with the goal of calling bases, clustering across samples based on consensus sequence similarity, and then finally writing output in various useful formats.
Step 3: Recap
Recall that we clustered reads within samples in Step 3. Reads that are sufficiently
similar (based on the specified sequence similarity threshold) are grouped together
in clusters separated by “//”. We examined the head of one of the sample cluster
files at the end of the last exercise, but here we’ve cherry picked a couple additional
Anolis elusters with more pronounced features.
Here’s a nice homozygous cluster, with probably one read with sequencing error:
0082e23d9badff5470eeb45ac0fdd2bd;size=5;*
TGCATGTAGTGAAGTCCGCTGTGTACTTGCGAGAGAATGAGTAGTCCTTCATGCA
a2c441646bb25089cd933119f13fb687;size=1;+
TGCATGTAGTGAAGTCCGCTGTGTACTTGCGAGAGAATGAGCAGTCCTTCATGCA
Here’s a probable heterozygote, or perhaps repetitive element – a little bit messier (note the indels):
0091f3b72bfc97c4705b4485c2208bdb;size=3;*
TGCATACAC----GCACACA----GTAGTAGTACTACTTTTTGTTAACTGCAGCATGCA
9c57902b4d8e22d0cda3b93f1b361e78;size=3;-
TGCATACAC----ACACACAACCAGTAGTAGTATTACTTTTTGTTAACTGCAGCATGCA
d48b3c7b5a0f1840f54f6c7808ca726e;size=1;+
TGCATACAC----ACAAACAACCAGTTGTAGTACTACTTTTTGTTAACTGCAGCATGAA
fac0c64aeb8afaa5dfecd5254b81b3c0;size=1;+
TGCATACAC----GCACACAACCAGTAGTAGTACTACTTTTTGTTAACTGCAGCATGTA
f31cbca6df64e7b9cb4142f57e607a88;size=1;-
TGCATGCACACACGCACGCAACCAGTAGTTGTACTACTTTTTGTTAACTGCAGCATGCA
935063406d92c8c995d313b3b22c6484;size=1;-
TGCATGCATACACGCCCACAACCAGTAGTAGTACAACTTTATGTTAACTGCAGCATGCA
d25fcc78f14544bcb42629ed2403ce74;size=1;+
TGCATACAC----GCACACAACCAGTAGTAGTACTACTTTTTGTTAATTGCAGCATGCA
Here’s a nasty one!
008a116c7a22d6af3541f87b36a8d895;size=3;*
TGCATTCCTATGGGAATCATGAAGGGGCTTCTCTCTCCCTCA-TTTTTAAAGCGACCCTTTCCAAACTTGGTACAT----
a7bde31f2034d2e544400c62b1d3cbd5;size=2;+
TGCATTCCTATGGGAAACATGAAGGGACTTCTCTCTCCCTCG-TTTTTAAAGTGACTCTGTCCAAACTTGGTACAT----
107e1390e1ac8564619a278fdae3f009;size=2;+
TGCATTCCTATGGGAAACATGAAGGGGGTTCTCTCTCCCTCG-ATTTTAAAGCGACCCTGTCCAAACTTGGTACAT----
8f870175fb30eed3027b7aec436e93e6;size=2;+
TGCATTCCTATGGGAATCATGGAAGGGCTTCTCTCTCCCTCA-TTTTTAAAGCAACCCTGACCAAAGTTGGTACAT----
445157bc1e7540734bf963eb8629d827;size=2;+
TGCATTCCTACGGGAATCATGGAGGGGCTTCTCTCTCCCTCG-TTTTTAAAGCGACCCTGACCAAACTTGGTACAT----
9ddd2d8b6fb52157f17648682d09afda;size=1;+
TGCATTCCTATGAGAAACATGATGGGGCTTCTCTTTCCCTCATTTTTT--AGTTAGCCTTACCAAAGTTGGTACATT---
fc86d48758313be18587d6f185e5c943;size=1;+
TGCATTCCTGTGGGAAACATGAAGGGGCTTCTCTCTCCATCA-TTTTTAAAGCGACCCTGATCAAATTTGGTACAT----
243a5acbee6cd9cd223252a8bb65667e;size=1;+
TGCATTCCTATGGGAAACATGAAAGGGTTTCTCTCTCCCTCG-TTTTAAAAGCGACCCTGTCCAAACATGGTACAT----
55e50e131ec21fce8021f22de49bb7be;size=1;+
TGCATTCCAATGGGAAACATGAAAGGGCTTCTCTCTCCCTCG-TTTTTAAAGCGACCCTGTCCAAACTTGGTACAT----
For this final cluster it’s really hard to call by eye, that’s why we make the computer do it!
Step 4: Joint estimation of heterozygosity and error rate
In this step we jointly estimate sequencing error rate and heterozygosity to help us figure out which reads are “real” and which include sequencing error. We need to know which reads are “real” because in diploid organisms there are a maximum of 2 alleles at any given locus. If we look at the raw data and there are 5 or ten different “alleles”, and 2 of them are very high frequency, and the rest are singletons then this gives us evidence that the 2 high frequency alleles are good reads and the rest are probably junk. This step is pretty straightforward and pretty fast.
# Ensure you are in the workshop assembly directory
$ cd ~/ipyrad-assembly
$ ipyrad -p params-simdata.txt -s 4 -c 3
loading Assembly: simdata
from saved path: ~/ipyrad-assembly/simdata.json
-------------------------------------------------------------
ipyrad [v.0.9.26]
Interactive assembly and analysis of RAD-seq data
-------------------------------------------------------------
Parallel connection | radcamp2020-VirtualBox: 3 cores
Step 4: Joint estimation of error rate and heterozygosity
[####################] 100% 0:00:12 | inferring [H, E]
Parallel connection closed.
In terms of results, there isn’t as much to look at as in previous
steps, though you can invoke the -r flag to see the estimated
heterozygosity and error rate per sample.
$ ipyrad -p params-simdata.txt -r
Summary stats of Assembly simdata
------------------------------------------------
state reads_raw reads_passed_filter clusters_total clusters_hidepth hetero_est error_est
1A_0 4 19862 19862 1000 1000 0.001819 0.000761
1B_0 4 20043 20043 1000 1000 0.001975 0.000751
1C_0 4 20136 20136 1000 1000 0.002084 0.000745
1D_0 4 19966 19966 1000 1000 0.001761 0.000758
2E_0 4 20017 20017 1000 1000 0.001855 0.000764
2F_0 4 19933 19933 1000 1000 0.001940 0.000759
2G_0 4 20030 20030 1000 1000 0.001940 0.000763
2H_0 4 20199 20198 1000 1000 0.001786 0.000756
3I_0 4 19885 19885 1000 1000 0.001858 0.000758
3J_0 4 19822 19822 1000 1000 0.001980 0.000783
3K_0 4 19965 19965 1000 1000 0.001980 0.000761
3L_0 4 20008 20008 1000 1000 0.002071 0.000751
These are pretty typical error rate/heterozygosity ratios (error rate on the order of 10x lower). If these rates are on the same order this might be an indication that the clustering threshold is too permissive (i.e. reads from different loci are being clustered and error rate is inflated).
NB: Typical Illumina error rates are on the order of 0.001 per base, or rather 1 bad basecall per 1000 bases, so if your error rate is much higher than this it could be something to investigate further.
NB: Another thing to think about, within species genetic diveristy tends to be on the order of 0.001 (Homo) to ~0.05 (Drosophila) (see Leffler et al. 2012). If your “mean hetero” value is much larger than this, or larger than might be expected given the natural history of your focal organism, your
clust_thresholdparameter may be too permissive.
Step 5: Consensus base calls
Step 5 uses the inferred error rate and heterozygosity per sample to call the consensus of sequences within each cluster. Here we are identifying what we believe to be the real haplotypes at each locus within each sample.
$ ipyrad -p params-simdata.txt -s 5 -c 3
loading Assembly: simdata
from saved path: ~/ipyrad-assembly/simdata.json
-------------------------------------------------------------
ipyrad [v.0.9.26]
Interactive assembly and analysis of RAD-seq data
-------------------------------------------------------------
Parallel connection | radcamp2020-VirtualBox: 3 cores
Step 5: Consensus base/allele calling
Mean error [0.00076 sd=0.00001]
Mean hetero [0.00192 sd=0.00011]
[####################] 100% 0:00:02 | calculating depths
[####################] 100% 0:00:00 | chunking clusters
[####################] 100% 0:00:47 | consens calling
[####################] 100% 0:00:01 | indexing alleles
Parallel connection closed.
In-depth operations of step 5:
- calculating depths - A simple refinement of the H/E estimates.
- chunking clusters - Again, breaking big files into smaller chunks to aid parallelization.
- consensus calling - Actually perform the consensus sequence calling
- indexing alleles - Keeping track of phase information
And here the important information is the number of reads_consens.
This is the number of retained reads within each sample that we’ll send on
to the next step. Retained reads must pass filters on read depth tolerance
(both mindepth_majrule and maxdepth), maximum number of uncalled
bases (max_Ns_consens) and maximum number of heterozygous sites
(max_Hs_consens) per consensus sequence. This number will almost always
be lower than clusters_hidepth.
$ cat simdata_consens/s5_consens_stats.txt
clusters_total filtered_by_depth filtered_by_maxH filtered_by_maxN reads_consens nsites nhetero heterozygosity
1A_0 1000 0 0 0 1000 89949 155 0.00172
1B_0 1000 0 0 0 1000 89937 165 0.00183
1C_0 1000 0 0 0 1000 89944 177 0.00197
1D_0 1000 0 0 0 1000 89929 151 0.00168
2E_0 1000 0 0 0 1000 89945 157 0.00175
2F_0 1000 0 0 0 1000 89933 167 0.00186
2G_0 1000 0 0 0 1000 89924 164 0.00182
2H_0 1000 0 0 0 1000 89946 150 0.00167
3I_0 1000 0 0 0 1000 89932 158 0.00176
3J_0 1000 0 0 0 1000 89944 168 0.00187
3K_0 1000 0 0 0 1000 89938 172 0.00191
3L_0 1000 0 0 0 1000 89924 173 0.00192
Step 6: Cluster across samples
Step 6 clusters consensus sequences across samples. Now that we have good estimates for haplotypes within samples we can try to identify similar sequences at each locus between samples. We use the same clustering threshold as step 3 to identify sequences between samples that are probably homologous, based on sequence similarity.
Note on performance of each step: Steps 3 and 6 generally take considerably longer than any of the other steps, due to the resource intensive clustering and alignment phases. These can take on the order of 10-100x as long as the next longest running step. Fortunately, with the data we use during this workshop, step 6 will actually be really fast.
NB: The recent update to ipyrad v.0.9.* included massive optimizations for step 6 for both de novo and reference based assemblies.
$ ipyrad -p params-simdata.txt -s 6 -c 3
loading Assembly: simdata
from saved path: ~/ipyrad-assembly/simdata.json
-------------------------------------------------------------
ipyrad [v.0.9.26]
Interactive assembly and analysis of RAD-seq data
-------------------------------------------------------------
Parallel connection | radcamp2020-VirtualBox: 3 cores
Step 6: Clustering/Mapping across samples
[####################] 100% 0:00:02 | concatenating inputs
[####################] 100% 0:00:03 | clustering across
[####################] 100% 0:00:02 | building clusters
[####################] 100% 0:00:13 | aligning clusters
Parallel connection closed.
In-depth operations of step 6:
- concatenating inputs - Gathering all consensus files and preprocessing to improve performance
- clustering across - Cluster by similarity threshold across samples
- building clusters - Group similar reads into clusters
- aligning clusters - Align within each cluster
Since in general the stats for results of each step are sample based, the output
of -r will only display what we had seen after step 5, so calling ipyrad
with -r after step 6 won’t be that informative. It might be more enlightening
to consider the output of step 6 by examining the file that contains the reads
clustered across samples:
# The output file from step 6 is in fasta format (not gzipped), so we use cat
# to view it, and take the first 26 lines.
cat simdata_across/simdata_clust_database.fa | head -n 26
1A_0_102
TGCAGAAACAGTAGCGGCCCATCTTTTTAAACTTTTACCAAGTCTGTGCAGCCGACCGATCTGAAGAGGTTTACACCGATATGAGGATGGGA
1B_0_90
TGCAGAAACAGTAGCGGCCCATCTTTTTAAACTTTTACCAAGTCTGTGCAGCCGACCGATCTGAAGAGGTTTACACCGATATGAGGATGG--
1C_0_98
TGCAGAAACAGTAGCGGCCCATCTTTTTAAACTTTTACCAAGTCTGTGCAGCCGACCGATCTGAAGAGGTTTACACCGATATGAGGATGG--
1D_0_102
TGCAGAAACAGTAGCGGCCCATCTTTTTAAACTTTTACCAAGTCTGTGCAGCCGACCGATCTGAAGAGGTTTACACCGATATGAGGATGG--
2E_0_97
TGCAGAAACAGTAGCGGCCCATCTTTTTAAACTTTTACCAAGTCTGTGCAGCCGACCGATCTGAAGAGGTTTACACCGATATGAGGATGG--
2F_0_93
TGCAGAAACAGTAGCGGCCCATCTTTTTAAACTTTTACYAAGTCTGTGCAGCCGACCGATCTGAAGAGGTTTACACCGATATGAGGATGG--
2G_0_998
TGCAGAAACAGTAGCGGCCCATCTTTTTAAACTTTTACTAAGTCTGTGCAGCCGACCGATCTGAAGAGGTTTACACCGATATGAGGATGG--
2H_0_107
TGCAGAAACAGTAGCGGCCCATCTTTTTAAACTTTTACCAAGTCTGTGCAGCCGACCGATCTGAAGAGGTTTACACCGATATGAGGATGG--
3I_0_106
TGCAGAAACAGTAGCGGCCCATCTTTTTAAACTTTTACCAAGTCTGTGCAGCCGACCGATCTGAAGAGGTTTACACCGATATGAGGATGG--
3J_0_934
TGCAGAAACAGTAGCGGCCCATCTTTTTAAACTTTTACCAAGTCTGTGCAGCCGACCGATCTGAAGAGGTTTACACCGATATGAGGATGG--
3K_0_337
TGCAGAAACAGTAGCGGCCCATCTTTTTAAACTTTTACCAAGTCTGTGCAGCCGACCGATCTGAAGAGGTTTACACCGATATGAGGATAG--
3L_0_94
TGCAGAAACAGTAGCGGCCCATCTTTTTAAACTTTTACCAAGTCTGTGCAGCCGACCGATCTGAAGAGGTTTACACCGATATGAGGATGG--
//
//
The final output of step 6 is a file in simdata_across called
simdata_clust_database.fa. This file contains all aligned reads across all
samples. Executing the above command you’ll see the output above which shows
all the reads that align at one particular locus. You’ll see the sample name of
each read followed by the sequence of the read at that locus for that sample.
If you wish to examine more loci you can increase the number of lines you want
to view by increasing the value you pass to head in the above command (e.g.
... | head -n 300).
Pro tip: You can also use
lessto look at all the loci, i.e.less simdata_across/simdata_clust_database.fa. Exitlessby pushing theqkey to quit.
Step 7: Filter and write output files
The final step is to filter the data and write output files in many convenient file formats. First we apply filters for maximum number of indels per locus, max heterozygosity per locus, max number of snps per locus, and minimum number of samples per locus. All these filters are configurable in the params file. You are encouraged to explore different settings, but the defaults are quite good and quite conservative.
To run step 7:
$ ipyrad -p params-simdata.txt -s 7 -c 3
loading Assembly: simdata
from saved path: ~/ipyrad-assembly/simdata.json
-------------------------------------------------------------
ipyrad [v.0.9.26]
Interactive assembly and analysis of RAD-seq data
-------------------------------------------------------------
Parallel connection | radcamp2020-VirtualBox: 3 cores
Step 7: Filtering and formatting output files
[####################] 100% 0:00:12 | applying filters
[####################] 100% 0:00:02 | building arrays
[####################] 100% 0:00:00 | writing conversions
Parallel connection closed.
A new directory is created called simdata_outfiles, and you may inspect
the contents:
$ ls simdata_outfiles/
simdata.loci simdata.phy simdata.seqs.hdf5 simdata.snps simdata.snps.hdf5 simdata.snpsmap simdata_stats.txt
This directory contains all the output files specified by the output_formats
parameter in the params file. The defaults will create two different version of
phylip output, one including the full sequence simdata.phy and one including
only variable sites simdata.snps, as well as a .snpsmap file which
indicates the location of each snp within each locus, a simdata.vcf file
including all the SNPs in VCF format, and the simdata.loci file which is
ipyrad’s internal format recording the full sequence for each sample at each
locus. The full list of available output formats and detailed explanations of
each of these is available in the ipyrad output formats documentation.
NB: To get generate all available output files from ipyrad step 7 you can specify
*for theoutput_formatsparameter in the params file.
The other important file generated by step 7 is the simdata_stats.txt which
gives extensive and detailed stats about the final assembly. A quick overview
of the blocks in the stats file:
$ less simdata_outfiles/simdata_stats.txt
Step 7 stats: applied filters
## The number of loci caught by each filter.
## ipyrad API location: [assembly].stats_dfs.s7_filters
total_filters applied_order retained_loci
total_prefiltered_loci 0 0 1000
filtered_by_rm_duplicates 0 0 1000
filtered_by_max_indels 0 0 1000
filtered_by_max_SNPs 0 0 1000
filtered_by_max_shared_het 0 0 1000
filtered_by_min_sample 0 0 1000
total_filtered_loci 0 0 1000
This block indicates how filtering is impacting your final dataset. Each
filter is applied in order from top to bottom, and the number of loci
removed because of each filter is shown in the applied_order column. The
total number of retained_loci after each filtering step is displayed in
the final column. This is a good place for inspecting how your filtering
thresholds are impacting your final dataset. For example, you might see
that most loci are being filterd by min_sample_locus (a very common
result), in which case you might reduce this threshold in your params file
and re-run step 7 in order to retain more loci.
We can look at the Anolis data again to get a feel for what real data
might look more like. Here you can see that more than half of the loci
are getting filtered by min_sample, and this is very typical of RAD-like
datasets, especially if the expectation is that RAD-data should look
kind of like really big multi-locus data. This expecation has the tendency
of inflating the min_samples_locus value, leading to drastic losses of data.
## The number of loci caught by each filter.
## ipyrad API location: [assembly].stats_dfs.s7_filters
total_filters applied_order retained_loci
total_prefiltered_loci 7366 0 7366
filtered_by_rm_duplicates 250 250 7116
filtered_by_max_indels 29 29 7087
filtered_by_max_snps 146 5 7082
filtered_by_max_shared_het 549 434 6648
filtered_by_min_sample 3715 3662 2986
filtered_by_max_alleles 872 68 2918
total_filtered_loci 2918 0 2918
Step 7 stats: number of loci per sample
Next ipyrad provides a simple summary of the number of loci retained for each sample in the final dataset. Pretty straightforward. If you have some samples that have very low sample_coverage here it might be good to remove them and re-run step 7.
## The number of loci recovered for each Sample.
## ipyrad API location: [assembly].stats_dfs.s7_samples
sample_coverage
1A_0 1000
1B_0 1000
1C_0 1000
1D_0 1000
2E_0 1000
2F_0 1000
2G_0 1000
2H_0 1000
3I_0 1000
3J_0 1000
3K_0 1000
3L_0 1000
Step 7 stats: locus coverage
locus_coverage indicates the number of loci that contain exactly a given
number of samples, and sum_coverage is just the running total of these
in ascending order. So here, if it weren’t being filtered, locus coverage
in the 1 column would indicate singletons (only one sample at this locus),
and locus coverage in the 12 column indicates loci with full coverage
(all samples have data at these loci).
## The number of loci for which N taxa have data.
## ipyrad API location: [assembly].stats_dfs.s7_loci
locus_coverage sum_coverage
1 0 0
2 0 0
3 0 0
4 0 0
5 0 0
6 0 0
7 0 0
8 0 0
9 0 0
10 0 0
11 0 0
12 1000 1000
Zzzzz. Actually, it’s good that this stat is boring because it means ipyrad is working correctly ;p. However, let’s return to the Anolis data to see a more realistic locus coverage result.
## The number of loci for which N taxa have data.
## ipyrad API location: [assembly].stats_dfs.s7_loci
locus_coverage sum_coverage
1 0 0
2 0 0
3 0 0
4 778 778
5 588 1366
6 451 1817
7 371 2188
8 297 2485
9 237 2722
10 196 2918
That’s more like it, but also remember this is a very small, cherry picked dataset already, with relatively shallow divergence. For much larger datasets (in the 100s of samples) it’s not uncommon to recover no loci shared across all samples.
Note: It’s important to notice that locus coverage below your
min_sample_locusparameter setting will all naturally equal 0, since by definition these are being removed.
Step 7 stats: snps per locus
Whereas the previous block indicated samples per locus, below we
are looking at SNPs per locus. In a similar fashion as above,
these columns record the counts of loci containing given numbers
of variable sites and parsimony informative sites (pis). For example,
in the 2 row, this indicates the number of loci with 2 variable
sites (174), and the number of loci with 2 pis (48). The sum_*
columns simply indicate the running total in ascending order.
Note: This block can be a little tricky because loci can end up getting double-counted. For example, a locus with 1 pis, and 2 autapomorphies will be counted once in the 3 row for
var, and once in the 1 row forpis. Apply care when interpreting these values.
## The distribution of SNPs (var and pis) per locus.
## var = Number of loci with n variable sites (pis + autapomorphies)
## pis = Number of loci with n parsimony informative site (minor allele in >1 sample)
## ipyrad API location: [assembly].stats_dfs.s7_snps
var sum_var pis sum_pis
0 15 0 337 0
1 56 56 379 379
2 114 284 201 781
3 208 908 51 934
4 198 1700 23 1026
5 147 2435 6 1056
6 123 3173 3 1074
7 67 3642 0 1074
8 44 3994 0 1074
9 13 4111 0 1074
10 8 4191 0 1074
11 3 4224 0 1074
12 3 4260 0 1074
13 1 4273 0 1074
Step 7 stats: aggregated sample stats
The final block displays statistics for each sample in the final dataset. Many
of these stats will already be familiar, but this provides a nice compact view
on how each sample is represented in the output. The one new stat here is
loci_in_assembly, which indicates how many loci each sample has data for.
## Final Sample stats summary
state reads_raw reads_passed_filter clusters_total clusters_hidepth hetero_est error_est reads_consens loci_in_assembly
1A_0 7 19862 19862 1000 1000 0.001819 0.000761 1000 1000
1B_0 7 20043 20043 1000 1000 0.001975 0.000751 1000 1000
1C_0 7 20136 20136 1000 1000 0.002084 0.000745 1000 1000
1D_0 7 19966 19966 1000 1000 0.001761 0.000758 1000 1000
2E_0 7 20017 20017 1000 1000 0.001855 0.000764 1000 1000
2F_0 7 19933 19933 1000 1000 0.001940 0.000759 1000 1000
2G_0 7 20030 20030 1000 1000 0.001940 0.000763 1000 1000
2H_0 7 20199 20198 1000 1000 0.001786 0.000756 1000 1000
3I_0 7 19885 19885 1000 1000 0.001858 0.000758 1000 1000
3J_0 7 19822 19822 1000 1000 0.001980 0.000783 1000 1000
3K_0 7 19965 19965 1000 1000 0.001980 0.000761 1000 1000
3L_0 7 20008 20008 1000 1000 0.002071 0.000751 1000 1000
Rerunning step 7 to include all output formats
For our downstream analysis we’ll need more than just the default output
formats, so lets rerun step 7 and generate all supported output formats. This
can be accomplished by editing the params-simdata.txt and setting the
requested output_formats to * (again, the wildcard character):
* ## [27] [output_formats]: Output formats (see docs)
After this we must now re-run step 7, but this time including the -f
flag, to force overwriting the output files that were previously generated.
$ ipyrad -p params-simdata.txt -s 7 -c 3 -f
loading Assembly: simdata
from saved path: ~/ipyrad-assembly/simdata.json
-------------------------------------------------------------
ipyrad [v.0.9.26]
Interactive assembly and analysis of RAD-seq data
-------------------------------------------------------------
Parallel connection | radcamp2020-VirtualBox: 3 cores
Step 7: Filtering and formatting output files
[####################] 100% 0:00:12 | applying filters
[####################] 100% 0:00:03 | building arrays
[####################] 100% 0:00:04 | writing conversions
[####################] 100% 0:00:01 | indexing vcf depths
[####################] 100% 0:00:01 | writing vcf output
Parallel connection closed.
Congratulations! You’ve completed your first RAD-Seq assembly. Now you can try
applying what you’ve learned to assemble your own real data. Please consult the
ipyrad online documentation for details about
many of the more powerful features of ipyrad, including reference sequence
mapping, assembly branching, and the analysis toolkit, which includes
extensive downstream analysis tools for such things as clustering and
population assignment, phylogenetic tree inference, quartet-based species tree
inference, and much more.
References
Leffler, Ellen M., et al. “Revisiting an old riddle: what determines genetic diversity levels within species?.” PLoS biology 10.9 (2012): e1001388.