Skip to the content.

ipyrad command line tutorial - Part II

This is the second part of the full tutorial for the command line interface for ipyrad. In the previous section we imported our data, did some QC, and created clusters of similar reads within each sample. In this section, we continue with the assembly, with the goal of calling bases, clustering across samples based on consensus sequence similarity, and then finally writing output in various useful formats.

Each grey cell in this tutorial indicates a command line interaction. Lines starting with $ indicate a command that should be executed in a terminal connected to the USP cluster, for example by copying and pasting the text into your terminal. All lines in code cells beginning with ## are comments and should not be copied and executed. Elements in code cells surrounded by angle brackets (e.g. ) are variables that need to be replaced by the user. All other lines should be interpreted as output from the issued commands.

## Example Code Cell.
## Create an empty file in my home directory called `watdo.txt`
$ touch ~/watdo.txt

## Print "wat" to the screen
$ echo "wat"
wat

Getting set up to continue the assembly

As a reminder, we are running assembly of the simulate data inside binder instances running on “the cloud”. A small headache is that if you let your binder sit long enough it’ll time out and die, in which case you’ll have to redo all the setup, config, and assembly up to the point where you paused. If your binder dies for whatever reason you can grab and run the binder-reinstall.sh and it’ll bring you right back up to speed!

$ wget https://radcamp.github.io/NYC2019/binder-reinstall.sh
$ bash binder-reinstall.sh

Step 3: Recap

Recall that we clustered reads within samples in Step 3. Reads that are sufficiently similar (based on the specified sequence similarity threshold) are grouped together in clusters separated by “//”. We examined the head of one of the sample cluster files at the end of the last exercise, but here we’ve cherry picked a couple clusters with more pronounced features.

Here’s a nice homozygous cluster, with probably one read with sequencing error:

0082e23d9badff5470eeb45ac0fdd2bd;size=5;*
TGCATGTAGTGAAGTCCGCTGTGTACTTGCGAGAGAATGAGTAGTCCTTCATGCA
a2c441646bb25089cd933119f13fb687;size=1;+
TGCATGTAGTGAAGTCCGCTGTGTACTTGCGAGAGAATGAGCAGTCCTTCATGCA

Here’s a probable heterozygote, or perhaps repetitive element – a little bit messier (note the indels):

0091f3b72bfc97c4705b4485c2208bdb;size=3;*
TGCATACAC----GCACACA----GTAGTAGTACTACTTTTTGTTAACTGCAGCATGCA
9c57902b4d8e22d0cda3b93f1b361e78;size=3;-
TGCATACAC----ACACACAACCAGTAGTAGTATTACTTTTTGTTAACTGCAGCATGCA
d48b3c7b5a0f1840f54f6c7808ca726e;size=1;+
TGCATACAC----ACAAACAACCAGTTGTAGTACTACTTTTTGTTAACTGCAGCATGAA
fac0c64aeb8afaa5dfecd5254b81b3c0;size=1;+
TGCATACAC----GCACACAACCAGTAGTAGTACTACTTTTTGTTAACTGCAGCATGTA
f31cbca6df64e7b9cb4142f57e607a88;size=1;-
TGCATGCACACACGCACGCAACCAGTAGTTGTACTACTTTTTGTTAACTGCAGCATGCA
935063406d92c8c995d313b3b22c6484;size=1;-
TGCATGCATACACGCCCACAACCAGTAGTAGTACAACTTTATGTTAACTGCAGCATGCA
d25fcc78f14544bcb42629ed2403ce74;size=1;+
TGCATACAC----GCACACAACCAGTAGTAGTACTACTTTTTGTTAATTGCAGCATGCA

Here’s a nasty one!

008a116c7a22d6af3541f87b36a8d895;size=3;*
TGCATTCCTATGGGAATCATGAAGGGGCTTCTCTCTCCCTCA-TTTTTAAAGCGACCCTTTCCAAACTTGGTACAT----
a7bde31f2034d2e544400c62b1d3cbd5;size=2;+
TGCATTCCTATGGGAAACATGAAGGGACTTCTCTCTCCCTCG-TTTTTAAAGTGACTCTGTCCAAACTTGGTACAT----
107e1390e1ac8564619a278fdae3f009;size=2;+
TGCATTCCTATGGGAAACATGAAGGGGGTTCTCTCTCCCTCG-ATTTTAAAGCGACCCTGTCCAAACTTGGTACAT----
8f870175fb30eed3027b7aec436e93e6;size=2;+
TGCATTCCTATGGGAATCATGGAAGGGCTTCTCTCTCCCTCA-TTTTTAAAGCAACCCTGACCAAAGTTGGTACAT----
445157bc1e7540734bf963eb8629d827;size=2;+
TGCATTCCTACGGGAATCATGGAGGGGCTTCTCTCTCCCTCG-TTTTTAAAGCGACCCTGACCAAACTTGGTACAT----
9ddd2d8b6fb52157f17648682d09afda;size=1;+
TGCATTCCTATGAGAAACATGATGGGGCTTCTCTTTCCCTCATTTTTT--AGTTAGCCTTACCAAAGTTGGTACATT---
fc86d48758313be18587d6f185e5c943;size=1;+
TGCATTCCTGTGGGAAACATGAAGGGGCTTCTCTCTCCATCA-TTTTTAAAGCGACCCTGATCAAATTTGGTACAT----
243a5acbee6cd9cd223252a8bb65667e;size=1;+
TGCATTCCTATGGGAAACATGAAAGGGTTTCTCTCTCCCTCG-TTTTAAAAGCGACCCTGTCCAAACATGGTACAT----
55e50e131ec21fce8021f22de49bb7be;size=1;+
TGCATTCCAATGGGAAACATGAAAGGGCTTCTCTCTCCCTCG-TTTTTAAAGCGACCCTGTCCAAACTTGGTACAT----

For this final cluster it’s really hard to call by eye, that’s why we make the computer do it!

Step 4: Joint estimation of heterozygosity and error rate

In this step we jointly estimate sequencing error rate and heterozygosity to help us figure out which reads are “real” and which include sequencing error. We need to know which reads are “real” because in diploid organisms there are a maximum of 2 alleles at any given locus. If we look at the raw data and there are 5 or ten different “alleles”, and 2 of them are very high frequency, and the rest are singletons then this gives us evidence that the 2 high frequency alleles are good reads and the rest are probably junk. This step is pretty straightforward, and pretty fast. Run it like this:

$ cd ipyrad-workshop
$ ipyrad -p params-peddrad.txt -s 4 -c 1
  loading Assembly: peddrad
  from saved path: ~/ipyrad-workshop/peddrad.json

 -------------------------------------------------------------
  ipyrad [v.0.9.13]
  Interactive assembly and analysis of RAD-seq data
 -------------------------------------------------------------
  Parallel connection | jupyter-dereneaton-2dipyrad-2dqk37slac: 1 cores

  Step 4: Joint estimation of error rate and heterozygosity
  [####################] 100% 0:00:12 | inferring [H, E]

  Parallel connection closed.

In terms of results, there isn’t as much to look at as in previous steps, though you can invoke the -r flag to see the estimated heterozygosity and error rate per sample.

$ ipyrad -p params-peddrad.txt -r
Summary stats of Assembly peddrad
------------------------------------------------
      state  reads_raw  reads_passed_filter  refseq_mapped_reads  ...  clusters_hidepth  hetero_est  error_est  reads_consens
1A_0      4      19835                19835                19835  ...              1000    0.001842   0.000773           1000
1B_0      4      20071                20071                20071  ...              1000    0.001861   0.000751           1000
1C_0      4      19969                19969                19969  ...              1000    0.002045   0.000761           1000
1D_0      4      20082                20082                20082  ...              1000    0.001813   0.000725           1000
2E_0      4      20004                20004                20004  ...              1000    0.002006   0.000767           1000
2F_0      4      19899                19899                19899  ...              1000    0.002045   0.000761           1000
2G_0      4      19928                19928                19928  ...              1000    0.001858   0.000765           1000
2H_0      4      20110                20110                20110  ...              1000    0.002129   0.000730           1000
3I_0      4      20078                20078                20078  ...              1000    0.001961   0.000749           1000
3J_0      4      19965                19965                19965  ...              1000    0.001950   0.000748           1000
3K_0      4      19846                19846                19846  ...              1000    0.001959   0.000768           1000
3L_0      4      20025                20025                20025  ...              1000    0.001956   0.000753           1000

Illumina error rates are on the order of 0.01% per base, so your error rates will ideally be in this neighborhood. Also, under normal conditions error rate will be much, much lower than heterozygosity (on the order of 10x lower). If the error rate is »0.01% then you might be using too permissive a clustering threshold. Just a thought.

Step 5: Consensus base calls

Step 5 uses the inferred error rate and heterozygosity per sample to call the consensus of sequences within each cluster. Here we are identifying what we believe to be the real haplotypes at each locus within each sample.

$ ipyrad -p params-peddrad.txt -s 5 -c 1
  loading Assembly: peddrad
  from saved path: ~/ipyrad-workshop/peddrad.json

 -------------------------------------------------------------
  ipyrad [v.0.9.13]
  Interactive assembly and analysis of RAD-seq data
 -------------------------------------------------------------
  Parallel connection | jupyter-dereneaton-2dipyrad-2dqk37slac: 1 cores

  Step 5: Consensus base/allele calling
  Mean error  [0.00075 sd=0.00001]
  Mean hetero [0.00195 sd=0.00010]
  [####################] 100% 0:00:01 | calculating depths
  [####################] 100% 0:00:00 | chunking clusters
  [####################] 100% 0:01:03 | consens calling
  [####################] 100% 0:00:03 | indexing alleles

  Parallel connection closed.

In-depth operations of step 5:

$ ipyrad -p params-peddrad.txt -r
  loading Assembly: peddrad
  from saved path: ~/ipyrad-workshop/peddrad.json

Summary stats of Assembly peddrad
------------------------------------------------
      state  reads_raw  reads_passed_filter  refseq_mapped_reads  ...  clusters_hidepth  hetero_est  error_est  reads_consens
1A_0      5      19835                19835                19835  ...              1000    0.001842   0.000773           1000
1B_0      5      20071                20071                20071  ...              1000    0.001861   0.000751           1000
1C_0      5      19969                19969                19969  ...              1000    0.002045   0.000761           1000
1D_0      5      20082                20082                20082  ...              1000    0.001813   0.000725           1000
2E_0      5      20004                20004                20004  ...              1000    0.002006   0.000767           1000
2F_0      5      19899                19899                19899  ...              1000    0.002045   0.000761           1000
2G_0      5      19928                19928                19928  ...              1000    0.001858   0.000765           1000
2H_0      5      20110                20110                20110  ...              1000    0.002129   0.000730           1000
3I_0      5      20078                20078                20078  ...              1000    0.001961   0.000749           1000
3J_0      5      19965                19965                19965  ...              1000    0.001950   0.000748           1000
3K_0      5      19846                19846                19846  ...              1000    0.001959   0.000768           1000
3L_0      5      20025                20025                20025  ...              1000    0.001956   0.000753           1000

And here the important information is the number of reads_consens. This is the number of retained reads within each sample that we’ll send on to the next step. Retained reads must pass filters on read depth tolerance (both mindepth_majrule and maxdepth), maximum number of uncalled bases (max_Ns_consens) and maximum number of heterozygous sites (max_Hs_consens) per consensus sequence. This number will almost always be lower than clusters_hidepth.

Step 6: Cluster across samples

Step 6 clusters consensus sequences across samples. Now that we have good estimates for haplotypes within samples we can try to identify similar sequences at each locus among samples. We use the same clustering threshold as step 3 to identify sequences among samples that are probably sampled from the same locus, based on sequence similarity.

Note on performance of each step: Steps 3 and 6 generally take considerably longer than any of the steps, due to the resource intensive clustering and alignment phases. These can take on the order of 10-100x as long as the next longest running step. Fortunately, with the simulated data, step 6 will actually be really fast.

$ ipyrad -p params-peddrad.txt -s 6 -c 1
  loading Assembly: peddrad
  from saved path: ~/ipyrad-workshop/peddrad.json

 -------------------------------------------------------------
  ipyrad [v.0.9.13]
  Interactive assembly and analysis of RAD-seq data
 -------------------------------------------------------------
  Parallel connection | jupyter-dereneaton-2dipyrad-2dpnwm5vfx: 1 cores

  Step 6: Clustering/Mapping across samples
  [####################] 100% 0:00:01 | concatenating inputs
  [####################] 100% 0:00:04 | clustering across
  [####################] 100% 0:00:00 | building clusters
  [####################] 100% 0:00:35 | aligning clusters

  Parallel connection closed.

In-depth operations of step 6:

Since in general the stats for results of each step are sample based, the output of -r will only display what we had seen after step 5, so this is not that informative.

It might be more enlightening to consider the output of step 6 by examining the file that contains the reads clustered across samples:

$ cat peddrad_across/peddrad_clust_database.fa | head -n 27
#1A_0,@1B_0,@1C_0,@1D_0,@2E_0,@2F_0,@2G_0,@2H_0,@3I_0,@3J_0,@3K_0,@3L_0
>1A_0_11
TGCAGGCGTAGTAAGCTTGGATGGGAGCGACCACCCGAACGAGATATCATTCACAACGTTATACATACACTGCGCnnnnCCATTATATGGTGTGATATACGTATCCTCAAACCGAATTACAAAACGATGTGCTTACGGCGTAATCTTGGTCCCG
>1B_0_16
TGCAGGCGTAGTAAGCTTGGATGGGAGCGACCACCCGAACGAGATATCATTCACAACGTTATACATACACTGCGCnnnnCCATTATATGGTGTGATATACGTATCCTCAAACCGAATTACAAAACGATGTGCTTACGGCGTAATCTTGGTCCCG
>1C_0_678
TGCAGGCGTAGTAAGCTTGCATGGGAGCGACCACCCGAACGAGATATCAATCACAACGTTATACATACACTGCGCnnnnCCATTATATGGTGTGATATACGWATCCTCAAACCGAATTACAAAACGATGTGCTTACGGCGTAATCTTGGTCCCG
>1D_0_509
TGCAGGCGTAGTAAGCTTGCATGGGAGCGACCACCCGAACGAGATATCATTCACAACGTTATACATACACTGCGCnnnnCCATTATATGGTGTGATATACGTATCCTCAAACCGAATTACAAAACGATGTGCTTACGGCGTAATCTTGGTCCCG
>2E_0_859
TGCAGGCGTAGTAAGCTTGCATGGGAGCGACCWCCCGAACGAGATATCATTCACAACGTTATACATACACTGCGCnnnnCCATTATATGGTGTGATATACGTATCCTCAAACCGAATTACAAAACGATGTGCTTACGGCGTAATCTTGGTCCCG
>2F_0_533
TGCAGGCGTAGTAAGCTTGCATGGGAGCGACCACCCGAACGAGATATCATTCACAACGTTATACATACACTGCGCnnnnCCATTATATGGTGTGATATACGTATCCTCAAACCGAATTACAAAACGATGTGCTTACGGCGTAATCTTGGTCCCG
>2G_0_984
TGCAGGCGTAGTAAGCTTGCATGGGAGCGACCACCCGAACGAGATATCATTCACAACGTTATACATACACTGCGCnnnnCCATTATATGGTGTGATATACGTATCCTCAAACCGAATTACAAAACGATGTGCTTACGGCGTAATCTTGGTCCCG
>2H_0_529
TGCAGGCGTAGTAAGCTTGCATGGGAGCGACCACCCGAACGAGATATCATTCACAACGTTATACATACACTGCGCnnnnCCATTATATGGTGTGATATACGTATCCTCAAACCGAATTACAAAACGATGTGCTTACGGCGTAATCTTGGTCCCG
>3I_0_286
TGCAGGCGTAGTAAGCTTGCATGCGAGCGACCACCCGAACGAGATATCATTCACAACGTTATACATACACTGCGCnnnnCCATTATATGGTGTTATATACGTATCCTCAAACCGAATTACAAAACGATGTGCTTACGGCGTAATCTTGGTCCCG
>3J_0_255
TGCAGGCGTAGTAAGCTTGCATGCGAGCGACCACCCGAACGAGATATCATTCACAACGTTATACATACACTGCGCnnnnCCATTATATGGTGTTATATACGTATCCTCAAACCGAATTACAAAACGATGTGCTTACGGCGTAATCTTGGTCCCG
>3K_0_264
TGCAGGCGTAGTAAGCTTGCATGCGAGCGACCACCCGAACGAGATATCATTCACAACGTTATACATACACTGCGCnnnnCCATTATATGGTGTTATATACGTATCCTCAAACCGAATTACAAAACGATGTGCTTACGGCGTAATCTTGGTCCCG
>3L_0_865
TGCAGGCGTAGTAAGCTTGCATGCGAGCGACCACCCGAACGAGATATCATTCACAACGTTATACATACACTGCGCnnnnCCATTATATGGTGTTATAYACGTATCCTCAAACCGAATTACAAAACGATGTGCTTACGGCGTAATCTTGGTCCCG
//
//

Again, the simulated data are a little boring. Here’s something you might see more typically with real data:

punc_IBSPCRIB0361_10
TdGCATGCAACTGGAGTGAGGTGGTTTGCATTGATTGCTGTATATTCAATGCAAGCAACAGGAATGAAGTGGATTTCTTTGGTCACTATATACTCAATGCA
punc_IBSPCRIB0361_1647
TGCATGCAACAGGAGTGANGTGrATTTCTTTGRTCACTGTAyANTCAATGYA
//
//
punc_IBSPCRIB0361_100
TGCATCTCAACGTGGTCTCGTCACATTTCAAGGCGCACATCAGAATGCAGTACAATAATCCCTCCCCAAATGCA
punc_MUFAL9635_687
TGCATCTCAACATGGTCTCGTCACATTTCAAGGCGCACATCAGAATGCAGTACAATAATCCCTCCCCAAATGCA
punc_ICST764_3619
TGCATCTCAACGTGGTCTCGTCACATTTCAAGGCGCACATCAGAATGCAGTACAATAATCCCTCCCCAAATGCA
punc_JFT773_4219
TGCATCTCAACGTGGTCTCGTCACATTTCAAGGCGCACATCAGAATGCAGTACAATAATCCCTCCCCAAATGCA
punc_MTR05978_111
TGCATCTCAACGTGGTCTCGTCACATTTCAAGGCGCACATCAGAATGCAGTACAATAATCCCTCCCCAAATGCA
punc_MTR17744_1884
TGCATCTCAACGTGGTCTCGTCACATTTCAAGGCGCACATCAGAATGCA-------------------------
punc_MTR34414_3503
TGCATCTCAACGTGGTCTCGTCACATTTCAAGGCGCACATCAGAATGCAGTACAATAATCCCTCCCCAAATGCA
//
//
punc_IBSPCRIB0361_1003
TGCATAATGGACTTTATGGACTCCATGCCGTCGTTGCACGTACCGTAATTGTGAAATGCAAGATCGGGAGCGGTT
punc_MTRX1478_1014
TGCATAATGGACTTTATGGACTCCATGCCGTCGTTGCACGTACCGTAATTGTGAAATGCA---------------
//
//

The final output of step 6 is a file in peddrad_across called peddrad_clust_database.fa. This file contains all aligned reads across all samples. Executing the above command you’ll see all the reads that align at each locus. You’ll see the sample name of each read followed by the sequence of the read at that locus for that sample. If you wish to examine more loci you can increase the number of lines you want to view by increasing the value you pass to head in the above command (e.g. ... | head -n 300).

Step 7: Filter and write output files

The final step is to filter the data and write output files in many convenient file formats. First, we apply filters for maximum number of indels per locus, max heterozygosity per locus, max number of snps per locus, and minimum number of samples per locus. All these filters are configurable in the params file. You are encouraged to explore different settings, but the defaults are quite good and quite conservative.

To run step 7:

$ ipyrad -p params-peddrad.txt -s 7 -c 1
  loading Assembly: peddrad
  from saved path: ~/ipyrad-workshop/peddrad.json

 -------------------------------------------------------------
  ipyrad [v.0.9.13]
  Interactive assembly and analysis of RAD-seq data
 -------------------------------------------------------------
  Parallel connection | jupyter-dereneaton-2dipyrad-2dpnwm5vfx: 1 cores

  Step 7: Filtering and formatting output files
  [####################] 100% 0:00:07 | applying filters
  [####################] 100% 0:00:02 | building arrays
  [####################] 100% 0:00:01 | writing conversions

  Parallel connection closed.

In-depth operations of step 7:

Step 7 generates output files in the peddrad_outfiles directory. All the output formats specified by the output_formats parameter will be generated here. Let’s see what’s created by default:

$ ls peddrad_outfiles/
peddrad.loci  peddrad.phy  peddrad.seqs.hdf5  peddrad.snps  peddrad.snps.hdf5  peddrad.snpsmap  peddrad_stats.txt

ipyrad always creates the peddrad.loci file, as this is our internal format, as well as the peddrad_stats.txt file, which reports final statistics for the assembly (more below). The other files created fall in to 2 categories: files that contain the full sequence (i.e. the peddrad.phy and peddrad.seqs.hdf5 files) and files that contain only variable sites (i.e. the peddrad.snps and peddrad.snps.hdf5 files). The peddrad.snpsmap is a file which maps SNPs to loci, which is used downstream in the analysis toolkit for sampling unlinked SNPs.

The most informative, human-readable file here is peddrad_stats.txt which gives extensive and detailed stats about the final assembly. A quick overview of the different sections of this file:

$ cat peddrad_outfiles/peddrad_stats.txt
## The number of loci caught by each filter.
## ipyrad API location: [assembly].stats_dfs.s7_filters

                            total_filters  applied_order  retained_loci
total_prefiltered_loci                  0              0           1000
filtered_by_rm_duplicates               0              0           1000
filtered_by_max_indels                  0              0           1000
filtered_by_max_SNPs                    0              0           1000
filtered_by_max_shared_het              0              0           1000
filtered_by_min_sample                  0              0           1000
total_filtered_loci                     0              0           1000

This block indicates how filtering is impacting your final dataset. Each filter is applied in order from top to bottom, and the number of loci removed because of each filter is shown in the applied_order column. The total number of retained_loci after each filtering step is displayed in the final column. This is a good place for inspecting how your filtering thresholds are impacting your final dataset. For example, you might see that most loci are being filterd by min_sample_locus (a very common result), in which case you might reduce this threshold in your params file and re-run step 7 in order to retain more loci. You can use branching, so you can re-run part of the analysis, without overwriting the output you already generated.

The next block shows a simple summary of the number of loci retained for each sample in the final dataset. Pretty straightforward. If you have some samples that have very low sample_coverage here it might be good to remove them and re-run step 7. Also this can be done by using branching.

## The number of loci recovered for each Sample.
## ipyrad API location: [assembly].stats_dfs.s7_samples

      sample_coverage
1A_0             1000
1B_0             1000
1C_0             1000
1D_0             1000
2E_0             1000
2F_0             1000
2G_0             1000
2H_0             1000
3I_0             1000
3J_0             1000
3K_0             1000
3L_0             1000

The next block is locus_coverage, which indicates the number of loci that contain exactly a given number of samples, and sum_coverage is just the running total of these in ascending order. So here, if it weren’t being filtered, locus coverage in the 1 column would indicate singletons (only one sample at this locus), and locus coverage in the 10 column indicates loci with full coverage (all samples have data at these loci).

Note: It’s important to notice that locus coverage below your min_sample_locus parameter setting will all naturally equal 0, since by definition these are being removed.

## The number of loci for which N taxa have data.
## ipyrad API location: [assembly].stats_dfs.s7_loci

    locus_coverage  sum_coverage
1                0             0
2                0             0
3                0             0
4                0             0
5                0             0
6                0             0
7                0             0
8                0             0
9                0             0
10               0             0
11               0             0
12            1000          1000

Whereas the previous block indicated samples per locus, below we are looking at SNPs per locus. In a similar fashion as above, these columns record the counts of loci containing given numbers of variable sites and parsimony informative sites (pis). For example, in the 2 row, this indicates the number of loci with 2 variable sites (174), and the number of loci with 2 pis (48). The sum_* columns simply indicate the running total in ascending order.

Note: This block can be a little tricky because loci can end up getting double-counted. For example, a locus with 1 pis, and 2 autapomorphies will be counted once in the 3 row for var, and once in the 1 row for pis. Apply care when interpreting these values.

The distribution of SNPs (var and pis) per locus.
## var = Number of loci with n variable sites (pis + autapomorphies)
## pis = Number of loci with n parsimony informative site (minor allele in >1 sample)
## ipyrad API location: [assembly].stats_dfs.s7_snps
## The "reference" sample is included if present unless 'exclude_reference=True'

    var  sum_var  pis  sum_pis
0     1        0  163        0
1     5        5  288      288
2    20       45  264      816
3    46      183  160     1296
4    66      447   70     1576
5   111     1002   36     1756
6   164     1986   13     1834
7   141     2973    5     1869
8   122     3949    1     1877
9   121     5038    0     1877
10   76     5798    0     1877
11   57     6425    0     1877
12   30     6785    0     1877
13   14     6967    0     1877
14   15     7177    0     1877
15    4     7237    0     1877
16    3     7285    0     1877
17    4     7353    0     1877

The next block displays statistics for each sample in the final dataset. Many of these stats will already be familiar, but this provides a nice compact view on how each sample is represented in the output. The one new stat here is loci_in_assembly, which indicates how many loci each sample has data for.

## Final Sample stats summary
      state  reads_raw  reads_passed_filter  refseq_mapped_reads  refseq_unmapped_reads  clusters_total  clusters_hidepthhetero_est  error_est  reads_consens  loci_in_assembly
1A_0      7      19835                19835                19835                      0            1000              1000  0.001842   0.000773           1000              1000
1B_0      7      20071                20071                20071                      0            1000              1000  0.001861   0.000751           1000              1000
1C_0      7      19969                19969                19969                      0            1000              1000  0.002045   0.000761           1000              1000
1D_0      7      20082                20082                20082                      0            1000              1000  0.001813   0.000725           1000              1000
2E_0      7      20004                20004                20004                      0            1000              1000  0.002006   0.000767           1000              1000
2F_0      7      19899                19899                19899                      0            1000              1000  0.002045   0.000761           1000              1000
2G_0      7      19928                19928                19928                      0            1000              1000  0.001858   0.000765           1000              1000
2H_0      7      20110                20110                20110                      0            1000              1000  0.002129   0.000730           1000              1000
3I_0      7      20078                20078                20078                      0            1000              1000  0.001961   0.000749           1000              1000
3J_0      7      19965                19965                19965                      0            1000              1000  0.001950   0.000748           1000              1000
3K_0      7      19846                19846                19846                      0            1000              1000  0.001959   0.000768           1000              1000
3L_0      7      20025                20025                20025                      0            1000              1000  0.001956   0.000753           1000              1000

The final block displays some very brief, but informative, summaries of missingness in the assembly at both the sequence and the SNP level:

## Alignment matrix statistics:
sequence matrix size: (12, 148725), 0.00% missing sites.
snps matrix size: (12, 7353), 0.00% missing sites.

For some downstream analyses we might need more than just the default output formats, so lets rerun step 7 and generate all supported output formats. This can be accomplished by editing the params-peddrad.txt file and setting the requested output_formats to * (again, the wildcard character):

$ nano params-peddrad.txt

And change this line:

*                        ## [27] [output_formats]: Output formats (see docs)

After this we must now re-run step 7, but this time including the -f flag, to force overwriting the output files that were previously generated. More information about all supported output formats can be found in the ipyrad docs.

$ ipyrad -p params-peddrad.txt -s 7 -c 1 -f

Congratulations! You’ve completed your first RAD-Seq assembly. Now you can try applying what you’ve learned to assemble your own real data. Please consult the ipyrad online documentation for details about many of the more powerful features of ipyrad, including reference sequence mapping, assembly branching, and the extensive analysis toolkit, which includes extensive downstream analysis tools for such things as clustering and population assignment, phylogenetic tree inference, quartet-based species tree inference, and much more.