RADCamp San Francisco 2024 - Day 1
Overview of the morning activities:
- Intro to ipyrad resources
- Software setup
- RADseq data quality control (QC)
- ipyrad assembly of simulated data Part I
Intro ipyrad Resources
- ipyrad documentation (detailed explanations and tutorials)
- ipyrad gitter channel (a chat room for getting help)
- ipyrad github repository (reporting issues)
Acessing IBSS JupyterHub
For this workshop we will use a cloud server hosted by CAS. You should be on either the CAS internal or Guest wifi. Open a browser window and go to:
You will see a login screen. Your username is the name of the email address you registered with (everything before the ‘@’). The password is the same.
Once logged in you’ll see the JupyterHub File Browser and Launcher panes.
NB: The IBSS JupyterHub server is only accessible on-site at CAS, and will be turned off after the workshop.
Installing ipyrad
ipyrad uses conda, which is a package manager for python. We downloaded
the minconda installer
and saved it in the /data
directory, so you can run the installer from there.
bash /data/Miniconda-Linux-x86_64.sh
During the miniconda installation push the space bar until prompted and then type ‘yes’ to acknowledge the license agreement, and ‘yes’ to initialize conda. After it’s finished type ‘exit’ and then open another terminal. Your prompt should now look like this:
(base) iovercast@ibss-jupyterhub:~$
Now you can install ipyrad with conda like this (it will take 1-2 minutes):
conda install -c conda-forge -c bioconda ipyrad -y
Data Quality Control: Fastq format and FastQC
Each grey cell in this tutorial indicates a command line interaction.
Lines starting with $
indicate a command that should be executed
in a terminal, for example by copying and pasting the text into your
terminal. Elements in code cells surrounded by angle brackets (e.g.
## Example Code Cell.
## Create an empty file in my home directory called `watdo.txt`
$ touch ~/watdo.txt
## Print "wat" to the screen
$ echo "wat"
wat
To start the terminal on the jupyter dashboard, click “Terminal” in the Launcher.
Here we’ll use bash commands and command line arguments. If you have trouble remembering the different commands, you can find some very usefull commands on this cheat sheet.
Unpack the simulated example data
For this workshop, we provide example datasets, as well as toy genomes for
testing different assembly methods. For now we’ll go forward with the rad
example dataset. First we need to unpack the data, which are located in the tests
folder.
# Unpack the simulated data is stored in the /data directory
# `tar` is a program for reading and writing archive files, somewhat like zip
# -x eXtract from an archive
# -z unZip before extracting
# -f read from the File
$ tar -xzf /data/ipsimdata.tar.gz
# Take a look at what we just unpacked
$ ls ipsimdata
gbs_example_barcodes.txt pairddrad_example_R2_.fastq.gz pairgbs_wmerge_example_genome.fa
gbs_example_genome.fa pairddrad_wmerge_example_barcodes.txt pairgbs_wmerge_example_R1_.fastq.gz
gbs_example_R1_.fastq.gz pairddrad_wmerge_example_genome.fa pairgbs_wmerge_example_R2_.fastq.gz
pairddrad_example_barcodes.txt pairddrad_wmerge_example_R1_.fastq.gz rad_example_barcodes.txt
pairddrad_example_genome.fa pairddrad_wmerge_example_R2_.fastq.gz rad_example_genome.fa
pairddrad_example_genome.fa.fai pairgbs_example_barcodes.txt rad_example_genome.fa.fai
pairddrad_example_genome.fa.sma pairgbs_example_R1_.fastq.gz rad_example_genome.fa.sma
pairddrad_example_genome.fa.smi pairgbs_example_R2_.fastq.gz rad_example_genome.fa.smi
pairddrad_example_R1_.fastq.gz pairgbs_wmerge_example_barcodes.txt rad_example_R1_.fastq.gz
Data QC
The first step of any RADSeq assembly is to inspect your raw data to
estimate overall quality. Your input data will be in fastQ format, usually
ending in .fq
, .fastq
, .fq.gz
, or .fastq.gz
. The file(s) may be
compressed with gzip so that they have a .gz ending, but they do not need to be.
Now, we will use the less
command to look at what’s inside one of these files.
$ less ipsimdata/rad_example_R1_.fastq.gz
@lane1_locus0_2G_0_0 1:N:0:
CTCCAATCCTGCAGTTTAACTGTTCAAGTTGGCAAGATCAAGTCGTCCCTAGCCCCCGCGTCCGTTTTTACCTGGTCGCGGTCCCGACCCAGCTGCCCCC
+
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@lane1_locus0_2G_0_1 1:N:0:
CTCCAATCCTGCAGTTTAACTGTTCAAGTTGGCAAGATCAAGTCGTCCCTAGCCCCCGCGTCCGTTTTTACCTGGTCGCGGTCCCCACCCAGCTGCCCCC
+
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@lane1_locus0_2G_0_2 1:N:0:
CTCCAATCCTGCAGTTTAACTGTTCAAGTTGGCAAGATCAAGTCGTCCCTAGCCCCCGCGTCCGTTTTTACCTGGTCGCGGTCCCGACCCAGCTGCCCCC
+
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@lane1_locus0_2G_0_3 1:N:0:
CTCCAATCCTGCAGTTTAACTGTTCAAGTTGGCAAGATCAAGTCGTCCCTAGCCCCCGCGTCCGTTTTTACCTGGTCGCGGTCCCGACCCAGCTGCCCCC
+
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@lane1_locus0_2G_0_4 1:N:0:
CTCCAATCCTGCAGTTTAACTGTTCAAGTTGGCAAGATCAAGTCGTCCCTAGCCCCCGCGTCCGTTTTTACCTGGTCGCGGTCCCGACCCAGCTGCCCCC
+
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
Here we have our first look at a fastq formatted file. Each sequenced read is spread over four lines, one of which contains sequence and another the quality scores stored as ASCII characters. The other two lines are used as headers to store information about the read.
- Line 1: The name of the read (its location on the plate)
- Line 2: The sequence data
- Line 3: Unused
- Line 4: Quality scores for the base calls (see the FASTQ wikipedia for more details on this)
In this case the restriction enzyme leaves a TGCAG overhang. Can you find this
sequence in the raw data? Use /TGCAG
to search for strings inside of less
.
What’s going on with that other stuff at the beginning of each read?
NB: Type ‘q’ to exit less
.
To get a better view of the data quality, without looking at individual reads, we use automated approaches to check the quality. We will use FastQC to generate a sample-wide summary of data quality.
The logic of FastQC is that we want to obtain a high-level view of the quality of the sequencing. You may be able to detect low quality samples, but if you have a lot of samples, you may not want to run FastQC for every single file. Even running it for a few samples will give you good insight into overall quality of the sequencing run. For example, a key QC procedure involves inspecting average quality scores per base position and trimming read edges, which is where low quality base-calls tend to accumulate. In this figure, the X-axis shows the position on the read in base-pairs and the Y-axis depicts information about Phred quality score per base for all reads, including median (center red line), IQR (yellow box), and 10%-90% (whiskers). As an example, here is a very clean base sequence quality report for a 75bp RAD-Seq library. These reads have generally high quality across their entire length, with only a slight (barely worth mentioning) dip toward the end of the reads:
In contrast, here is a somewhat typical base sequence quality report for R1 of a 300bp paired-end Illumina run of ezRAD data:
This figure depicts a common artifact of current Illumina chemistry, whereby quality scores per base drop off precipitously toward the ends of reads, with the effect being magnified for read lengths > 150bp. The purpose of using FastQC to examine reads is to determine whether and how much to trim our reads to reduce sequencing error interfering with basecalling. In the above figure, as in most real dataset, we can see there is a tradeoff between throwing out data to increase overall quality by trimming for shorter length, and retaining data to increase value obtained from sequencing with the result of increasing noise toward the ends of reads.
Installing and running fastqc can be done like this:
conda install -c bioconda fastqc -y
# `-o .` will create output files in the current (.) directory
fastqc ipsimdata/rad_example_R1_.fastq.gz -o .
FastQC will indicate its progress in the terminal. This toy data will run quite quickly, but real data can take somewhat longer to analyse (10s of minutes).
FastQC will save the output as an html file in the folder you’re currently in.
You want to look at it in your browser window. So look in the file pane on the left
and click on rad_example_R1__fastqc.html
. This will open the FastQC report which
provides extensive information about the quality of the data, which we will
briefly review here.
Inspecting and Interpreting FastQC Output
FastQC generates an html file as output, and on the left you’ll see a summary of all the results, which highlights areas FastQC indicates may be worth further examination. We will only look at a few of these.
NB: The simulated data is very boring and too clean, so the following figures illustrate FastQC results for a real dataset (Anolis; Prates et al 2016).
Lets start with Per base sequence quality.
For the Anolis data the sequence quality per base is uniformly quite high, with dips only in the first and last 5 bases (again, this is typical for Illumina reads). Based on information from this plot we can see that the Anolis data doesn’t need any trimming, which is good.
Now lets look at the Per base sequence content
, which FastQC highlights with a
scary red X.
The squiggles indicate base composition per base position averaged across the
reads. It looks like the signal FastQC is concerned about here is related to
the extreme base composition bias of the first 5 positions. We happen to know
this is a result of the restriction enzyme overhang present in all reads
(TGCAT
in this case for the EcoT22I enzyme used), and so it is in fact of no
concern. Now lets look at Adapter Content
:
Here, we can see adapter contamination increases toward the tail of the reads, approaching 40% of total read content at the very end. The concern here is that if adapters represent some significant fraction of the read pool, then they will be treated as “real” data, and potentially bias downstream analysis. In the Anolis data this looks like it might be a real concern so we shall keep this in mind during step 2 of the ipyrad analysis, and incorporate 3’ read trimming and illumina adapter filtering.
Exercise: Run fastqc on real data samples
There are several examples of real fastq files in the /data/fastqs
directory. Practice running fastqc
on these files and interpreting the
results. See if you can answer these questions for each sample:
- How does the per base sequence quality look? Would you trim this data and if so where would you trim to?
- Can you identify the restriction enzyme recognition sequence from the per base sequence content report?
- Is there adapter contamination and if so does it look significant?
ipyrad assembly part I
References
Prates, I., Xue, A. T., Brown, J. L., Alvarado-Serrano, D. F., Rodrigues, M. T., Hickerson, M. J., & Carnaval, A. C. (2016). Inferring responses to climate dynamics from historical demography in neotropical forest lizards. Proceedings of the National Academy of Sciences, 113(29), 7978-7985.